Mutations of b-Catenin in Adrenocortical Tumors: Activation of the Wnt Signaling Pathway Is a Frequent Event in both Benign and Malignant Adrenocortical Tumors

Adrenocortical cancer is a rare cancer with a very poor prognosis. The genetic alterations identified to date in adrenocortical tumors are limited. Activating mutations of the Wnt signaling pathway have been observed in more frequent cancers, particularly digestive tract tumors. We investigated whether Wnt pathway activation is involved in adrenocortical tumorigenesis. In a series of 39 adrenocortical tumors, immunohistochemistry revealed abnormal cytoplasmic and/or nuclear accumulation of B-catenin in 10 of 26 adrenocortical adenomas and in 11 of 13 adrenocortical carcinomas. An activating somatic mutation of the b-catenin gene was shown in 7 of 26 adrenocortical adenomas and in 4 of 13 adrenocortical carcinomas; these mutations were observed only in adrenocortical tumors with abnormal B-catenin accumulation and most were point mutations altering the Ser of exon 3 (in the consensus GSK3-B/CK1 phosphorylation site). Functional studies showed that the activating Ser b-catenin mutation found in the adrenocortical cancer H295R cell line leads to constitutive activation of T-cell factor–dependent transcription. This is the first molecular defect to be reported with the same prevalence in both benign (27%) and malignant (31%) adrenocortical tumors. b-Catenin mutations are also the most frequent genetic defect currently known in adrenocortical adenomas. In adrenocortical adenomas, Bcatenin alterations are more frequent in nonfunctioning tumors, suggesting that B-catenin pathway activation might be mostly involved in the development of nonsecreting adrenocortical adenomas and adrenocortical carcinomas. The very frequent and substantial accumulation of Bcatenin in adrenocortical carcinomas suggests that other alterations might also be involved. This finding may contribute to new therapeutic approaches targeting the Wnt pathway in malignant adrenocortical tumors, for which limited medical therapy is available. (Cancer Res 2005; 65(17): 7622-7) Introduction Adrenocortical tumors can be diagnosed as adrenocortical adenomas or adrenocortical carcinomas, which have a very poor prognosis (1–3). Most sporadic adrenal tumors are monoclonal, suggesting that a somatic genetic defect occurs early during tumorigenesis (4). Somatic mutations of the tumor suppressor gene TP53 were initially reported, mostly in adrenal carcinomas (5). More recently, we have reported somatic inactivating mutations of the tumor suppressor gene PRKAR1A in a subgroup of adrenocortical adenomas responsible for Cushing’s syndrome (6). Consistent with the occurrence of adrenocortical tumors in the Li-Fraumeni and Beckwith-Wiedemann syndromes (7), allelic losses [loss of heterozygosity (LOH)] at the TP53 locus at 17p13 and the insulin-like growth factor II (IGF-II) locus at 11p15 have been observed in adrenocortical carcinomas (8). IGF-II overexpression is a major characteristic of adrenocortical carcinomas and has been suggested as a prognostic factor (9). However, the physiopathology of adrenocortical tumors is not well documented because very few genetic alterations have been identified in these tumors (10). Molecular studies have pinpointed activating mutations of the Wnt signaling pathway as the cause of many cancers (11–13). h-Catenin plays a central role in the Wnt signaling pathway. It has a structural role in cell-cell adhesion and is a transcription cofactor with T-cell factor/lymphoid enhancer factor (TCF/LEF) in the Wnt signaling pathway. In the absence of Wnt signaling, the level of h-catenin is low:h-catenin is phosphorylated at critical NH2-terminal residues by the GSK3-h bound to a scaffolding complex of axin and adenomatous polyposis proteins (APC) and subsequently the phosphorylated protein is degraded by the ubiquitin-proteasome system (14). Wnt stimulation leads to the inactivation of GSK3-h and thereby the stabilization of h-catenin in the cytoplasm. Consequently, h-catenin becomes available to bind the TCF/LEF family of transcription factors and to induce target gene expression (15). We report a study of the status of h-catenin by immunohistochemistry, DNA sequencing, and functional study of the H295R cell line to assess its contribution to adrenocortical tumorigenesis. Materials and Methods Patients. Patients included in the study were investigated for a sporadic adrenocortical tumor (other than Conn’s adenoma) in the Endocrinology Department of Cochin Hospital. None of the 39 patients presented features of any adrenocortical tumor–predisposing syndrome Requests for reprints: Jérôme Bertherat, Service des Maladies Endocriniennes et Métaboliques, Hôpital Cochin, 27 rue du Fg-St-Jacques, 75014, Paris, France. Phone: 15-841-1895; Fax: 14-633-8060; E-mail: [email protected]. I2005 American Association for Cancer Research. doi:10.1158/0008-5472.CAN-05-0593 Cancer Res 2005; 65: (17). September 1, 2005 7622 www.aacrjournals.org Research Article Research. on October 29, 2017. © 2005 American Association for Cancer cancerres.aacrjournals.org Downloaded from (Beckwith-Wiedemann, Carney complex, McCune-Albright, Multiple Endocrine Neoplasia type 1, or Li-Fraumeni syndrome). Clinical data, hormonal status, and tumor stage (McFarlane classification) were assessed as previously described (16, 17). Informed consent for the analysis of leukocyte and tumor DNA and for access to the data collected was obtained from all the patients, and the study was approved by an institutional review board (Comité Consultatif de Protection des Personnes dans la Recherche Biomédicale, Cochin Hospital, Paris). The allelic status at the 11p15 and 17p13 loci and IGF-II messenger abundance in tumors were determined as previously described (8). After surgery, patients were examined twice a year for 2 years and annually thereafter. Hormonal evaluation, chest X-ray, and computerized tomography scans of the abdomen and thorax were carried out at each evaluation for adrenocortical carcinoma. The patients were followed until their date of death, their last examination, or the end of the follow-up period. The minimal and the maximal follow-up periods were 12 and 159 months, respectively (mean 81.9 F 32.3). Human H295R cell line. The human adrenocortical cancer H295R cell line was grown as previously described (18) in DMEM/Ham’s F-12 supplemented with 2% Ultroser G (Biosepra, Fremont, CA), 2 mmol/L glutamine, 5 Ag/mL insulin, 5 Ag/mL transferrin, 5 ng/mL selenium, 50 units/mL penicillin, and 50 mg/mL streptomycin. Microscopy. The tumors were fixed in formalin, embedded in paraffin, and 4 Am sections were cut and stained with H&E-safran. The sections were examined to assess their Weiss score (0 to 9) on the basis of the presence or absence of the following nine histologic features: high mitotic rate, atypical mitoses, high nuclear grade, low percentage of clear cells, necrosis, diffuse tumor architecture, capsular invasion, sinusoidal invasion, and venous invasion (19). Immunohistochemical staining. Sections, 4 Am thick, from formalinfixed tissue embedded in paraffin were mounted on Superfrost/Plus glass slides. Immunohistochemistry for h-catenin was done as previously described (15). For negative controls, some sections were incubated without the primary antibody. The slides were counterstained with Mayer hematoxylin. Immunostaining was assessed by an investigator blinded to McFarlane stage, Weiss score, and outcome. The entirety of h-catenin–stained sections was examined. Immunohistochemical labeling was evaluated for the presence of membranous, cytoplasmic, and nuclear staining by a qualitative assessment, and cytoplasmic and/or nuclear staining was recorded as intracellular accumulation. The intensity of staining was not scored. Nucleic acid extraction and mutation analysis of the b-catenin gene. DNA was extracted from peripheral blood leukocytes using the Wizard Genomic DNA Purification KIT (Promega Corp., Madison, WI). Tumor DNA and RNA were purified by cesium chloride gradient ultracentrifugation as previously reported (20). cDNA was synthesized by Moloney murine leukemia virus-reverse transcriptase (Invitrogen, Groningen, the Netherlands) using 1 Ag of total RNA in a final volume of 40 mL. For mutation analysis, exon 3 and the flanking intronic sequences of the b-catenin gene were amplified by PCR from both tumoral and leukocyte DNA. The primers used were hCATEX2F (GAAAATCCAGCGTGGACAATG) and hCATEX4R (TCGAGTCATTGCATACTGTCC). Both strands of the amplified products were directly sequenced on an automated sequencer (ABI 3700; PerkinElmer, Boston, MA). To search for large b-catenin gene deletions, exon 3 was also amplified from tumor cDNA using the primers hCATF1 (GCGTGGACAATGGCTACTCAAG) and hCATR2 (TTCAGCACTCTGCTTGTGGTCC). The primer hCATR1 (TTCAGGGATTGCACGTGTGGC) was also used for sequencing for large b-catenin gene deletion analysis. Mutations were confirmed twice on two independent experiments. Cell line, transfection, and reporter assays. The human adrenocortical cancer H295R cell line was maintained as previously described (18). Transient transfections were done when cells were 60% to 70% confluent in 12-well plates using Effectene transfection reagent (Qiagen GmbH, Hilden, Germany). The total amount of transfected DNA (1.25 Ag per well) was kept constant by adding pcDNA3. A TK-Renilla plasmid (10 ng) was included in each transfection for monitoring of transfection efficiency. PTOPFLASH [containing two copies of the h-catenin/T-cell factor (TCF)-binding sites], pFOPFLASH (containing two mutated copies of the h-catenin/TCF-binding sites), and the expression plasmid encoding the dominant-negative form of TCF (pDNTCF4) were kindly provided by H. Clevers (Utrecht, the Netherlands); 0.25 Ag of pTOPFLASHor pFOPFLASHplasmid and growing quantities of pDNTCF4 ( from 50 ng to 1 Ag) were added per well. All experiments were done in triplicate and repeated at least thrice. Cells were lysed 36 hours after transfection and the luciferase and renilla activities were assayed using Promega Dual Luciferase Reporter Assay (Promega). The activity of the reporter constructs was expressed as normalized relative light units. Statistical analysis. The m test was used to compare rates of h-catenin delocalization or mutations between tumor groups. Statistical analyses were done using the StatView 5.0 program (SAS Institute, Cary, NC); significance was set at P < 0.05.